View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_high_23 (Length: 352)
Name: NF15541_high_23
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 36 - 161
Target Start/End: Original strand, 18992999 - 18993122
Alignment:
| Q |
36 |
gggtttagcataggttgttagtgaaagtgttaaatctctttcttcttcccatgtttgtgtaagtgacacgaactcaacaaagatgttgcgaagcatagaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
18992999 |
gggtttagcataggttgttagtgaaagtgttaaatctctttcttcttcccatgtttgggtgagtga-acgaactcaacaaa-atgttgcgaagcatagaa |
18993096 |
T |
 |
| Q |
136 |
accactcatcacctcaccgtcagaac |
161 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
18993097 |
accactcatcacctcaccgtcagaac |
18993122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 259 - 336
Target Start/End: Original strand, 18993220 - 18993297
Alignment:
| Q |
259 |
aaacctcaatcacaatctcactcttttcttcaacaacaacgagaacacgcttcttccttcatcactcgtcgttttcat |
336 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18993220 |
aaaccacaatcacaatctcactcttttcttcttcaacaacgagaacacgcttcttccttcatcactcgtcgttttcat |
18993297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University