View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_high_34 (Length: 249)
Name: NF15541_high_34
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_high_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 22 - 183
Target Start/End: Original strand, 22565316 - 22565478
Alignment:
| Q |
22 |
aaactcatgggatgagaaaagtaatgaatgtatatggccggtgggtaaatattttgggcccttagtactt-gaaaaatgatcatatgattcaggtgtcca |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22565316 |
aaactcatgggatgagaaaagtatcgaatgtatatggccggtgggtaaatattttgggcccttagtacttagaaaaatgatcatatgattcaggtgtcca |
22565415 |
T |
|
| Q |
121 |
cacacggttttacttattttatcatcacaagaaagacaccatctcaaatggtcccctatgtgg |
183 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
22565416 |
cacacggttttacttcttttatcatcacaagaaaggcacaatctcaaatggtcccctatgtgg |
22565478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University