View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_low_12 (Length: 544)
Name: NF15541_low_12
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 5e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 37693659 - 37693862
Alignment:
| Q |
17 |
gaaaggaagcaagtacgaaacatccccacgagaatatcctttctcatattccggattcctttactaccgtttttctaattctaattaaattaaatttcta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
37693659 |
gaaaggaagcaagtacgaaacatccccacaagaatatcctttctcatattccggattcctttagtactgttattctaattctaattaaattaaatttcta |
37693758 |
T |
 |
| Q |
117 |
tattttggttcagttttttctagaagttatttataatttttcatgtcataaaaaagttcaacaattaagaaatttccttttcaaggtctacagtcgtgtg |
216 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37693759 |
tattttggtcaagttttttctagaatttattgacaattttttatgtcataaaaaagttcaacaattaagaaatttccttttcaaggtctacagccgtgtg |
37693858 |
T |
 |
| Q |
217 |
aaat |
220 |
Q |
| |
|
|||| |
|
|
| T |
37693859 |
aaat |
37693862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University