View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_low_31 (Length: 319)
Name: NF15541_low_31
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_low_31 |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 3 - 300
Target Start/End: Complemental strand, 40753675 - 40753378
Alignment:
| Q |
3 |
gagattaaagttttgtcttggaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgtatgccgtgct |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40753675 |
gagattaaagttttgtcttgaaaatggatgttgaatagaaccaaaagcccgacttgcttttgtttgttgaggtgaggggtgggggtgtgtatgccgtgct |
40753576 |
T |
 |
| Q |
103 |
gctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgattcaagtatcattgttgtatggatgggg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40753575 |
gctgccctttagtttccttctggtgtatcggtttctactgtgagcttctgttttgccttcaatgttgtttgatttaagtatcattgttgtatggatgggg |
40753476 |
T |
 |
| Q |
203 |
taggtacttggtagtttatgttatgcgctacctgggagtgcttgctggaattgtttttaggtgtgttgtatttcttgcttcggggatagatagtgaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40753475 |
taggtacttggtagtttatgttatgcgctacctgggagtgcttgctggaattgtttttaggtgtgttgtatttcttgcttcggggatagatagtgaga |
40753378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 6670 - 6611
Alignment:
| Q |
187 |
tgttgtatggatggggtaggtacttggtagtttatgttatgcgctacctgggagtgcttg |
246 |
Q |
| |
|
|||||||| | |||| |||||| ||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
6670 |
tgttgtattgttgggataggtagttggtagcttatgtaatgtgctacctgggagtgcttg |
6611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 19472143 - 19472180
Alignment:
| Q |
3 |
gagattaaagttttgtcttggaaatggatgttgaatag |
40 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
19472143 |
gagattaaggttttgtcttggagatggatgttgaatag |
19472180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University