View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_low_35 (Length: 270)
Name: NF15541_low_35
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 22565737 - 22565999
Alignment:
| Q |
1 |
attggatttggttttttccttcaagattagcacaaatattttatgccaagttgctaactataattggataaagacacatatttgattaata----gctca |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22565737 |
attggatttttttttttccttcaagattagcacaaatattttatgctaagttgctaactataattggataaagacacatatttgattaataaatagctca |
22565836 |
T |
|
| Q |
97 |
aggtgaaactattagttccttttacttgttatggagtggggtgtgttattagcaatttatcaatgtggattgagttagatttctaaaggatgatgatcga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22565837 |
aggtgaaactattagttccttttacttgttatggagtggggtatgttattagcaatttatcaatgtggattgagttagatttctaaagcatgatgatcga |
22565936 |
T |
|
| Q |
197 |
atgttttaaccatctacaccaagatgtctataatttttgtgttattttaatttttcttatatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22565937 |
atgttttaaccatctacaccaagatgtctataatttttgtgttattttaatttttcttatatt |
22565999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University