View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15541_low_39 (Length: 247)
Name: NF15541_low_39
Description: NF15541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15541_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 22277078 - 22277295
Alignment:
| Q |
11 |
cagagatggagaaagtgaatggaaggagagcatctagatttgagggatattaggccggaaagcctggtaaggaacacaggtcagcaggttttatcctcta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22277078 |
cagagatggagaaagtgaatggaaggagagcatctagatttgagggatattaggccggaaagcctggtaaggaacacaggtcagcaggttttatcctcta |
22277177 |
T |
 |
| Q |
111 |
ggtttcttaatttcatcttgcaaggagcaccactctaaccatatctttttctgtttcaattcagtttttgttttccagtttacatttgcaattaaaaata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22277178 |
ggtttcttaatttcatcttgcaaggagcaccactctaaccatatctttttctgtttcaattcagtttttgttttccagtttacatttacaattaaaaata |
22277277 |
T |
 |
| Q |
211 |
tacaaatattttcctcac |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22277278 |
tacaaatattttcctcac |
22277295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University