View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15542_low_12 (Length: 289)
Name: NF15542_low_12
Description: NF15542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15542_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 273
Target Start/End: Complemental strand, 20487281 - 20487019
Alignment:
| Q |
11 |
caaaggaaatagcacttgaagaaactcatccaaatctcggttaaagttcacgcttccattgacaaatttgacacgtccagtgggataatatgaccattac |
110 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
20487281 |
caaagggaatagcacttgaggaaactcatccaaatctcgattaaaattcacgcttccattgacaaatttgacatgtccagtgggacaatatgaccattac |
20487182 |
T |
 |
| Q |
111 |
cattgaaaaattatcttcccccagtcaggacaatgtctattgtatgcattggaggtctggaaagagtctcaacaatatgaaacaaccgccatcttcagca |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20487181 |
cattgaaaaattatcttccctcagtcaggacaatgtctattgtatgcattggaggtctggaaagagtctcaacaatatgaaacaaccaccatcttcagca |
20487082 |
T |
 |
| Q |
211 |
actagaaagtcagtgcagcgttgacttaaggatcattcgcaaacgttgagagtgccaacatat |
273 |
Q |
| |
|
|| |||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
20487081 |
accagaaagtcagtgcagccttgacttaaggatctttcgcaaacgttgggagtgccaacatat |
20487019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 222
Target Start/End: Original strand, 9510135 - 9510195
Alignment:
| Q |
162 |
gaggtctggaaagagtctcaacaatatgaaacaaccgccatcttcagcaactagaaagtca |
222 |
Q |
| |
|
||||| ||||||||||||||||| |||||| ||||| |||| ||| ||||||||| |||| |
|
|
| T |
9510135 |
gaggtttggaaagagtctcaacagtatgaatcaaccttcatcatcaacaactagaaggtca |
9510195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University