View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15542_low_13 (Length: 277)
Name: NF15542_low_13
Description: NF15542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15542_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 124 - 262
Target Start/End: Complemental strand, 44151216 - 44151078
Alignment:
| Q |
124 |
cagacggatggtggtcttggttggactcagattatccacccaagaccgaccgtatcaatccatccacaatcgggtctactaacctatccaacctacttta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44151216 |
cagacggatggtggtcttggttggactcagattatccacccaaaaccgaccgtatcaatccatccacaatcgggtctactaacctatccaacccacttta |
44151117 |
T |
|
| Q |
224 |
acgatccgtgcctacaggacgtttggagcagttggtttg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44151116 |
acgatccgtgcctacaggacgtttggagcaggtggtttg |
44151078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 44151339 - 44151285
Alignment:
| Q |
1 |
agatataataactataacttgtgagtagtagtagtatatttgggccttggaaacc |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44151339 |
agatataataactataacttgtgagtagtagtagtatatttgggccttggaaacc |
44151285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University