View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15542_low_15 (Length: 269)
Name: NF15542_low_15
Description: NF15542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15542_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 258
Target Start/End: Complemental strand, 24656120 - 24656048
Alignment:
| Q |
186 |
attgtgtgtttattgtttaaagactagatagaagagtgatctaaattgagggtttaatcgttaatgatattct |
258 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24656120 |
attgtgtgttcattgtttaaagactagatagaagagtgatctaaattgagggtttactcgttaatgatattct |
24656048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 259
Target Start/End: Original strand, 29415210 - 29415288
Alignment:
| Q |
182 |
aaacattgtgtgtttattgtttaaa-gactagatagaagagtgatctaaattgagggtttaatcgttaatgatattctt |
259 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||| | ||||| | ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29415210 |
aaacattgtgtgttcattatttaaaagactagacaaaagaggggtctaaattgagggtttactcgttaatgatattctt |
29415288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 111
Target Start/End: Complemental strand, 13992499 - 13992461
Alignment:
| Q |
73 |
tattgtaacctgaacggtagtatttaaatacaagttgta |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
13992499 |
tattgtaaactgaacggtagtatttaaacacaagttgta |
13992461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University