View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15542_low_16 (Length: 268)
Name: NF15542_low_16
Description: NF15542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15542_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 40113722 - 40113972
Alignment:
| Q |
16 |
gcacaagtagttgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113722 |
gcacaagtagttgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtac |
40113821 |
T |
|
| Q |
116 |
ttcttatcatacataaccaacgtctataatattacaaaaaattgcttcatatggtttggtttggtatcctcacctatattcacatgtttcatacttcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113822 |
ttcttatcatacataaccaacgtctataatattacaaaaaattgcttcatatggtttggtttggtatcctcacctatattcacatgtttcatacttcata |
40113921 |
T |
|
| Q |
216 |
ataaagtaaatataaaattcatctcgacaaatatcatgaaacctagttgtt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113922 |
ataaagtaaatataaaattcatctcgacaaatatcatgaaacctagttgtt |
40113972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 27 - 116
Target Start/End: Original strand, 40120994 - 40121083
Alignment:
| Q |
27 |
tgcaaatgatgttgtcacagaaactgaactaaccaaaatccgtcttgtgagagcctttgttgaaacacaagatccatcttctaaggtact |
116 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40120994 |
tgcaaatgatgctgttacagaaactgaactaaccaaaatccgtcttgtgcgaccctttgttgaaacacaagatccatcttctaaggtact |
40121083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University