View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15543_high_9 (Length: 311)
Name: NF15543_high_9
Description: NF15543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15543_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 79 - 220
Target Start/End: Original strand, 2819861 - 2820003
Alignment:
| Q |
79 |
tctgtcttccttatctatacttcaatttcagatcgtaagtttttatttcaatttcataatataacttatacccatgcctattgttcacaaaatgttaata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2819861 |
tctgtcttccttatctatacttcaatttcacatcgtaagtttttatttcaatttcataatataacttatacccatgcctattcttcacaaaatgttaata |
2819960 |
T |
 |
| Q |
179 |
aataatttgttttggagaaatatttaa-ctgcttttgtattct |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2819961 |
aataatttgttttggagaaatatttaagctgcttttgtattct |
2820003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 78 - 127
Target Start/End: Complemental strand, 3405898 - 3405849
Alignment:
| Q |
78 |
ttctgtcttccttatctatacttcaatttcagatcgtaagtttttatttc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3405898 |
ttctgtcttccttatctatacttcaatttcagattgtaagtttttatttc |
3405849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 3405825 - 3405793
Alignment:
| Q |
192 |
ggagaaatatttaactgcttttgtattctagtt |
224 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
3405825 |
ggagaaatatttaactgcttttgtattatagtt |
3405793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 29657828 - 29657856
Alignment:
| Q |
26 |
tattgagaattgttaattgtaaaattgga |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29657828 |
tattgagaattgttaattgtaaaattgga |
29657856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University