View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15543_low_15 (Length: 302)
Name: NF15543_low_15
Description: NF15543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15543_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 35 - 302
Target Start/End: Complemental strand, 35205670 - 35205403
Alignment:
| Q |
35 |
ggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205670 |
ggataaaggttatgttgttaatgattgtttagcggttttggtagcattggcggagaatgtggatggtgctcgtgctgtattagaatgctcgggtttgtca |
35205571 |
T |
 |
| Q |
135 |
ttggttattgggattttgcaatctgcaaattcgagtgcggagaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205570 |
ttggttattgggattttgcaatctgcaaattcgcgtgcggagaaggagtactgtgtttccattttggtttcactatgtgttaatgttggtggagaggttg |
35205471 |
T |
 |
| Q |
235 |
ttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaatcttacctatgctact |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
35205470 |
ttagtgttttggcgaagcatgcttcggggattatgcctttgctttatgcaaatcttaccgatggtact |
35205403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University