View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15543_low_18 (Length: 236)
Name: NF15543_low_18
Description: NF15543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15543_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 23 - 186
Target Start/End: Complemental strand, 1842998 - 1842835
Alignment:
| Q |
23 |
catttagaagaagaaaacattgtagttaattgacatccccattttaaaagcattgcatcttggatattggttacagaaatgtgcaatccactggctattt |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
1842998 |
catttagaaaaagaaaacattgtagttaattgatatccccattttaaaagcattgcattttggatattggttacggaaatgtgcaatccactgcctattt |
1842899 |
T |
 |
| Q |
123 |
atagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1842898 |
atagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
1842835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 117 - 186
Target Start/End: Complemental strand, 1846432 - 1846363
Alignment:
| Q |
117 |
ctatttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1846432 |
ctatttataacaaaggtttcctctcaatgctttataagctgccagtgtgggacttattactatctctcta |
1846363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 117 - 186
Target Start/End: Complemental strand, 1848254 - 1848185
Alignment:
| Q |
117 |
ctatttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1848254 |
ctatttataagtaaggtttcctctcaatgctttataagacgccaatgtgggacttattactatctctcta |
1848185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 186
Target Start/End: Complemental strand, 1827717 - 1827650
Alignment:
| Q |
119 |
atttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
||||||||||||| || |||| ||||||| ||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1827717 |
atttatagctaagattccctctcaatgctatataagccgtcgatgtgggacttattactatctctcta |
1827650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 1824627 - 1824568
Alignment:
| Q |
120 |
tttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactat |
179 |
Q |
| |
|
|||||| | |||||||| || ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1824627 |
tttatatcaaaggtttcatctcaatgctatataagctgccgatgtgggacttattactat |
1824568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 101 - 186
Target Start/End: Complemental strand, 1845242 - 1845156
Alignment:
| Q |
101 |
atgtgcaatccactggctatttatagctaaggtttcctcccaatgctttat-aagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
||||||| |||||| |||||||||| ||||||||||||||||||| |||| || |||| |||||||| |||||||| |||| |||| |
|
|
| T |
1845242 |
atgtgcagtccactacctatttataggtaaggtttcctcccaatgcattataaatctgctgatgtgggtcttattacaatctttcta |
1845156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 117 - 181
Target Start/End: Complemental strand, 1819822 - 1819757
Alignment:
| Q |
117 |
ctatttatagctaaggtttcctcccaa-tgctttataagctgccgatgtgggacttattactatct |
181 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| ||||||||||||||||||| | |||||| |||| |
|
|
| T |
1819822 |
ctatttatagctaaggtttcctctcaaatgctatataagctgccgatgtgggtcatattacaatct |
1819757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 186
Target Start/End: Complemental strand, 1847434 - 1847377
Alignment:
| Q |
129 |
aaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| |||||||| |||| |||| |
|
|
| T |
1847434 |
aaggtttcctcccaatgcattataagctgccgttgtgggtcttattacaatctttcta |
1847377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 118 - 172
Target Start/End: Complemental strand, 1836442 - 1836388
Alignment:
| Q |
118 |
tatttatagctaaggtttcctcccaatgctttataagctgccgatgtgggactta |
172 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
1836442 |
tatttataactaaggtgtcctctaaatgctttataagcttccgatgtgggactta |
1836388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 170
Target Start/End: Complemental strand, 1828609 - 1828558
Alignment:
| Q |
119 |
atttatagctaaggtttcctcccaatgctttataagctgccgatgtgggact |
170 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
1828609 |
atttataacttaggtttcctctcaatgctttataaactgtcgatgtgggact |
1828558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 186
Target Start/End: Complemental strand, 1833067 - 1832999
Alignment:
| Q |
118 |
tatttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttattactatctctcta |
186 |
Q |
| |
|
|||||||||||| ||| ||||| | |||||||||| | || |||||||||||||| || | |||||||| |
|
|
| T |
1833067 |
tatttatagctatggtgtcctctcgatgctttatatgttgtcgatgtgggacttaatattgtctctcta |
1832999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 173
Target Start/End: Complemental strand, 1839845 - 1839789
Alignment:
| Q |
117 |
ctatttatagctaaggtttcctcccaatgctttataagctgccgatgtgggacttat |
173 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || |||||| || |||||||||||| |
|
|
| T |
1839845 |
ctatttaaagctaaggtttcctctcaatgccatacaagctgtcgttgtgggacttat |
1839789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University