View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15543_low_7 (Length: 390)
Name: NF15543_low_7
Description: NF15543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15543_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 352
Target Start/End: Original strand, 38666603 - 38666936
Alignment:
| Q |
19 |
ccagaaggttgtgattggacgattacgcgcatgaaattggcttgggaagaagcgacgacgccgacggcttgggattcggagannnnnnnagtttcttcgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38666603 |
ccagaaggttgtgattggacgattacgcgcatgaaattggcttgggaagaagcgacgacgccgacggcttgggattcggagagagggggagtttcttcgc |
38666702 |
T |
 |
| Q |
119 |
gggagagaattggagcgagagaggagaaatctttgagtgttcgttttgctttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggc |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666703 |
gggagagaattagagcgagagaggagaaatctttgagtgttcgttttgctttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggc |
38666802 |
T |
 |
| Q |
219 |
ggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgcgttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagaga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666803 |
ggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgcgttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagaga |
38666902 |
T |
 |
| Q |
319 |
gagaattgagatttcaaagccttttttgaaacgg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38666903 |
gagaattgagatttcaaagccttttttgaaacgg |
38666936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University