View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15544_high_10 (Length: 379)

Name: NF15544_high_10
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15544_high_10
NF15544_high_10
[»] chr2 (1 HSPs)
chr2 (190-362)||(15540815-15540996)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 190 - 362
Target Start/End: Complemental strand, 15540996 - 15540815
Alignment:
190 gattcgttgatgcggcagtggtatgcta--gctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct 287  Q
    ||||||||||||||||||||  ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15540996 gattcgttgatgcggcagtgtaatgctatagctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct 15540897  T
288 cttgacagt-------gnnnnnnnncaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaac 362  Q
    |||||||||       |        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15540896 cttgacagtgaaagtggtgaaaaaacaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaac 15540815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University