View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_16 (Length: 334)
Name: NF15544_high_16
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 3 - 320
Target Start/End: Complemental strand, 7845963 - 7845649
Alignment:
| Q |
3 |
tatactagttgtattatattatatcatattttagttacttatttttcaagtttctttttccaacgatgccaatatatgtatgaggcaaaatcgctttctc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7845963 |
tatactagttgtattatattatatcatattttagttacgtatttttcaagtttctttttccaacgatgccaatatatg----aggcaaaatcgctttctc |
7845868 |
T |
 |
| Q |
103 |
gaaaaaattattttggtattgctccaaaaaagctatttgacaaagactagaggaaataaatttttattggatggacccataaataaaaagagattataaa |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7845867 |
gaaaaaattattttgctattgctccaaaaaagctatttgacaaagactagaggaaataaatttttattggatggacccataaataaaaagagattataaa |
7845768 |
T |
 |
| Q |
203 |
tggccactggagcaagagtaagctgcatgaatgaatgagaaagcgattttgaagattttgattattgctttgagcaatt-ttttatttgctaattggtgt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
7845767 |
tggccactggagcaagagtaagctgcatgaaagaatgagaaagcgattttgaagattttgattattgctttgagcaatttttttatttgataattggtgt |
7845668 |
T |
 |
| Q |
302 |
gtactacaagggtatccct |
320 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7845667 |
gtactacaagggtatccct |
7845649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University