View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_24 (Length: 276)
Name: NF15544_high_24
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 25728479 - 25728543
Alignment:
| Q |
1 |
cagagaatactttttcatccaaaacttctacatatgcattggatatgctactcaatgtttgtcca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25728479 |
cagagaatactttttcatccaaaacttctacatatgcattggatatgctactcaatgtttgtcca |
25728543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 258
Target Start/End: Original strand, 25734020 - 25734095
Alignment:
| Q |
183 |
cagagttatttgcaaaagagtctgtgttagaagttgtaaaaatgaacatggagcaaggtataaatgagaacagttc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||| ||||| |||| |
|
|
| T |
25734020 |
cagagttatttgcaaaagagtctgtgttagaagttgtacaaatggacatggagcagagtataaatcagaacggttc |
25734095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 189 - 258
Target Start/End: Original strand, 25733519 - 25733588
Alignment:
| Q |
189 |
tatttgcaaaagagtctgtgttagaagttgtaaaaatgaacatggagcaaggtataaatgagaacagttc |
258 |
Q |
| |
|
|||| ||||||| ||||| |||||||| ||||||||||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
25733519 |
tattagcaaaagtgtctgcgttagaagctgtaaaaatgaacatagagcaaagtataaatgagaaaagttc |
25733588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 48
Target Start/End: Original strand, 25733785 - 25733830
Alignment:
| Q |
3 |
gagaatactttttcatccaaaacttctacatatgcattggatatgc |
48 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
25733785 |
gagaatacttttccatcaaaaacttctacatctgcattggatatgc |
25733830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University