View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_26 (Length: 257)
Name: NF15544_high_26
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_26 |
 |  |
|
| [»] scaffold0185 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0185 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0185
Description:
Target: scaffold0185; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 241
Target Start/End: Original strand, 4763 - 4992
Alignment:
| Q |
12 |
atgaaactagggtcgaggagaataaaattttcattataattttttccaccctattatctttccatgcgttcaataaattttttcaaaatactcctgattc |
111 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4763 |
atgaaactagggtcgaggagaataacattttgattataattttttccaccctattatctttcaatgcgttcaataaattttttcaaaatactcctgattc |
4862 |
T |
 |
| Q |
112 |
aaattttaaaattcgaactagattgttaggggaattcagattttggaatcagaaaaaacatgaaccgtatattctatatttaatttgttgtcaaatgtct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
4863 |
gaattttaaaattcgaactagattgttaggggaattaagattttggaatcagaaaaaacatgaaccgtgtattctatatttaatttgttgtcaaatgtat |
4962 |
T |
 |
| Q |
212 |
ctcttgattggagtagaatctccgcataaa |
241 |
Q |
| |
|
|| ||| || ||||||||||||||||||| |
|
|
| T |
4963 |
ctgctgactgtagtagaatctccgcataaa |
4992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 206
Target Start/End: Complemental strand, 27690796 - 27690704
Alignment:
| Q |
114 |
attttaaaattcgaactagattgttaggggaattcagattttggaatcagaaaaaacatgaaccgtatattctatatttaatttgttgtcaaa |
206 |
Q |
| |
|
|||||||||| ||||| | |||||||||||||||| |||| | |||| ||||||||| |||| |||||| | | || |||||| ||||||| |
|
|
| T |
27690796 |
attttaaaatccgaacaaaattgttaggggaattcggattatataatccgaaaaaacacgaactatatattatgtgttcaatttgatgtcaaa |
27690704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University