View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_32 (Length: 243)
Name: NF15544_high_32
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 21 - 243
Target Start/End: Complemental strand, 46235656 - 46235432
Alignment:
| Q |
21 |
gggtccctgtcagcttaactc--ttggtgaagacaatgtatcgtacaataataggttggagttcgaaccccaaacacgtcacttattcatcgtaaaatgt |
118 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
46235656 |
gggtccctgtcagcttaactcagtttgtgaagacaatgtatcgtacaataataggttggagttcgaacctcaaacacgtcccttattcatcgtaaaatgt |
46235557 |
T |
 |
| Q |
119 |
gaatttgtagtcgttagactacttgacnnnnnnngacacggatctcagacaagtgattggtgcgcgcggtgtgaatgtcactcataatttgttttccttt |
218 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
46235556 |
gaatttatagtcgttagactacttgacaaaaaaagacacggatctcagacaagtgattggtgcgcacggtgtgaatgtcactcataatttgttttcctct |
46235457 |
T |
 |
| Q |
219 |
agtttacactagtgtgattttgatt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46235456 |
agtttacactagtgtgattttgatt |
46235432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 113
Target Start/End: Complemental strand, 6801746 - 6801705
Alignment:
| Q |
72 |
ggttggagttcgaaccccaaacacgtcacttattcatcgtaa |
113 |
Q |
| |
|
|||||||||||||||||||||||| | |||| |||||||||| |
|
|
| T |
6801746 |
ggttggagttcgaaccccaaacaccttacttgttcatcgtaa |
6801705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University