View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_35 (Length: 213)
Name: NF15544_high_35
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 36622238 - 36622057
Alignment:
| Q |
12 |
agaagcaaagggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctcca |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622238 |
agaagcaaggggaagagatagatcatgtgagaaaagctaggcaaatgcaattttggtgggaaagccctgttgatgaacttggcttgaatgaattgctcca |
36622139 |
T |
 |
| Q |
112 |
gttaaaggtttctattgaggacctgaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttct |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622138 |
attaaaggtttctattgaggacctcaggaagaatcttggaaaaattgctagcaaatgcatgatggaacaatccaatgtttct |
36622057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University