View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_high_36 (Length: 212)
Name: NF15544_high_36
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 45 - 158
Target Start/End: Original strand, 35976631 - 35976744
Alignment:
| Q |
45 |
aatttagtttgatgtactatcatgtaacccttaacacctccatgagatagcgtgctattaaatttacgaacgctttttctaaccaaagaaaattaagaac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35976631 |
aatttagtttgatgtactatcatgtaacccttaaaacctcaatgagatagcgtgtaattaaatttacgaacgctttttgtaaccaaagaaaattaagaac |
35976730 |
T |
 |
| Q |
145 |
gcgttttaagaaag |
158 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35976731 |
gcgttttaagaaag |
35976744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University