View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_low_13 (Length: 379)
Name: NF15544_low_13
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 190 - 362
Target Start/End: Complemental strand, 15540996 - 15540815
Alignment:
| Q |
190 |
gattcgttgatgcggcagtggtatgcta--gctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct |
287 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15540996 |
gattcgttgatgcggcagtgtaatgctatagctcaggttgaagatagttctccggtgaaagtacaatgatattataaagagaaatcctatagaaaactct |
15540897 |
T |
 |
| Q |
288 |
cttgacagt-------gnnnnnnnncaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaac |
362 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15540896 |
cttgacagtgaaagtggtgaaaaaacaatgtccattggaatggcgtgtcgttacccttatatagtggtgtttgaccagtaac |
15540815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University