View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_low_22 (Length: 331)
Name: NF15544_low_22
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 14 - 312
Target Start/End: Complemental strand, 43855191 - 43854893
Alignment:
| Q |
14 |
agaatgggaaggttatgcccacaaacattgtgaatgctgaatcaaaaacattgtgaatacaaataacaattttgaatttcattnnnnnnnnncaagtaga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
43855191 |
agaatgggaaggttatgcccacaaacattgtgaatgctgaatcaaaaacattgtgaatacaaatagcaattttgaatttcattaaaaaaaaacaagtaga |
43855092 |
T |
 |
| Q |
114 |
agaaaaagacctcgaaatcatattaatggagtcatgcagtcatgaaatctccatcaaattgattgtaaaatacaattcataatatgagtcaactattcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855091 |
agaaaaagacctcgaaatcatattaatggagtcaagcagtcatgaaatctccatcaaattgattgtaaaatacaattcataatatgagtcaactattcat |
43854992 |
T |
 |
| Q |
214 |
catagaaaagatttgcgatttcacaaagataaaatatccaattttagaaaggtgctcaccaacataaacattgcgaacaacaaatcttaggagtcgggt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854991 |
catagaaaagatttgcgatttcacaaagataaaatatccaattttagaaaggtgctcaccaacataaacattgcgaacaacaaatcttaggagtcgggt |
43854893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University