View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_low_35 (Length: 250)
Name: NF15544_low_35
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_low_35 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 73 - 250
Target Start/End: Original strand, 46235239 - 46235416
Alignment:
| Q |
73 |
ttaaaaaattatttcatattcaatnnnnnnnnnttatattatttcatatcataaattcatcatgaaccccaagatgtgttgatnnnnnnnngtaaattta |
172 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46235239 |
ttaaaaaattatttcatattcaataaaaaaaaattatattatttcatatcataaattcatcatgaaccccaagatgtgttgataaaaaaaagtaaattta |
46235338 |
T |
 |
| Q |
173 |
aagggttttagtaaaatataattgacaattattatacttaatattttagagtaattatggtacttgatttgacttgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46235339 |
aagggttttagtaaaatataattgacaattattatacttaatattttagagtaattatggtacttgatttgacttgaa |
46235416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 46234754 - 46234827
Alignment:
| Q |
8 |
cgaagaatatacacctcttgaaccaattttgttagatacatgcacccctaaatttgtaacttgtattaaaaaat |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46234754 |
cgaaaaatatacacctcttgaaccaatttttttagatacatgcacccctaaatttgtaacttgtattaaaaaat |
46234827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University