View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15544_low_37 (Length: 248)
Name: NF15544_low_37
Description: NF15544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15544_low_37 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 48024953 - 48025183
Alignment:
| Q |
18 |
cgaagattggtcgagattgcgttgatgaaccggggaagttgttgggttttgtggattcgaggattatggggagagtgaaggaggaatttggcgtggttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48024953 |
cgaagattggtcgagattgcgttgatgaaccggggaagttgttgggttttgtggattccaggattatggggagagtgaaggaggaatttggggtggttgg |
48025052 |
T |
 |
| Q |
118 |
taaaaatgggtttgtgggtttaggggattttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48025053 |
taaaaatgggtttgtgggtttaggggattttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagtagatgaaactggttttgatttt |
48025152 |
T |
 |
| Q |
218 |
gggactttgtttgagattgagtgtgagagtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48025153 |
gggactttgtttgagattgagtgtgagagtt |
48025183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 48020167 - 48020394
Alignment:
| Q |
18 |
cgaagattggtcgagattgcgttgatgaaccggggaagttgttgggttttgtggattcgaggattatggggagagtgaaggaggaatttggcgtggttgg |
117 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||| || || ||||| ||||||||||||||||| ||||||||||||||||| ||||| || |
|
|
| T |
48020167 |
cgaagattggtcgagattgtgttgatgaaccggggaaattg---gggttggtggagtcgaggattatggggagggtgaaggaggaatttggggtggtggg |
48020263 |
T |
 |
| Q |
118 |
taaaaatgggtttgtgggtttaggggattttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
217 |
Q |
| |
|
| ||||||||||||||||||| || | ||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
48020264 |
tgaaaatgggtttgtgggtttgggaggttttaagaatgtgaggaatgtttatgattggaaaggtttgaaattggaagtggatgagactcattttgatttt |
48020363 |
T |
 |
| Q |
218 |
gggactttgtttgagattgagtgtgagagtt |
248 |
Q |
| |
|
|| ||||||||||||||||| ||||| |||| |
|
|
| T |
48020364 |
ggaactttgtttgagattgaatgtgaaagtt |
48020394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 51934557 - 51934784
Alignment:
| Q |
18 |
cgaagattggtcgagattgcgttgatgaaccggggaagttgttgggttttgtggattcgaggattatggggagagtgaaggaggaatttggcgtggttgg |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
51934557 |
cgaagattggtcgagattccgttgatgaaccagggaagttg---ggttttgtggattcgaggattatggggagagtgaaggaggaatttggggtggtggg |
51934653 |
T |
 |
| Q |
118 |
taaaaatgggtttgtgggtttaggggattttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
217 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51934654 |
taaaaatgggtttgtgggattagaggattttaggaatgtgatgaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
51934753 |
T |
 |
| Q |
218 |
gggactttgtttgagattgagtgtgagagtt |
248 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
51934754 |
gagactttgtttgagattgagtgtgagagtt |
51934784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 13727 - 13949
Alignment:
| Q |
18 |
cgaagattggtcgagattgcgttgatgaaccggggaagttgttgggttttgtggattcgaggattatggggagagtgaaggaggaatttggcgtggttgg |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
13727 |
cgaagattggtcgagattccgttgatgaactggggaagttg---ggttttgtggattcgaggattatggggagagtgaaggaggaatttggggtggtggg |
13823 |
T |
 |
| Q |
118 |
taaaaatgggtttgtgggtttaggggattttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
217 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13824 |
taaaaatgggtttgtgggattagggaagtttaggaatgtgaggaatgtttatgaatggaaaggtttgaaattggaagttgatgaaactggttttgatttt |
13923 |
T |
 |
| Q |
218 |
gggactttgtttgagattgagtgtga |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
13924 |
gggactttgtttgagattgagtgtga |
13949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University