View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15546_high_5 (Length: 295)
Name: NF15546_high_5
Description: NF15546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15546_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 19 - 139
Target Start/End: Complemental strand, 4406066 - 4405946
Alignment:
| Q |
19 |
cctttgacgaagatggcatctaaggttaagaaaaagactatgcttaatgcaattcatatacataatacccactctaagggtaggaaactagagtagttaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4406066 |
cctttgacgaagatggcatctaaggttaagaaaaagactatgcttaaggcaattcatatacataatacccactctaagggtaggaaaccagagtagttaa |
4405967 |
T |
 |
| Q |
119 |
ggatcttacgttgtgttcgtt |
139 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
4405966 |
ggatcttatgttgtgttcgtt |
4405946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 219 - 286
Target Start/End: Complemental strand, 4405873 - 4405805
Alignment:
| Q |
219 |
tgcttaataggttttggtcgatgtctc-cattatctttttgttctagtttctttttatatatatattct |
286 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4405873 |
tgcttaataggttttggtcgatgtctttcattatctttttgttctagtttctttttatgtatatattct |
4405805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University