View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15546_high_6 (Length: 273)
Name: NF15546_high_6
Description: NF15546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15546_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 21617348 - 21617069
Alignment:
| Q |
1 |
tttttatatttgaaatttttattcatattttcacaag-----------accataaaattaatgaataatttatgcatacattcatgcaaatagagaggct |
89 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21617348 |
tttttatatatgaaatttttatccatattttcacaaggccataatttgaccataaaactaatcaataatttatgcatacattcatgcaaatagggaggct |
21617249 |
T |
|
| Q |
90 |
taagagagagaaggaaaagtgttcatacagatttggggtaacccaagatgttggcaattgtagagttgagtagagagagtatggaagatatatctacacc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21617248 |
taagagagagaaggaaaagtgttcatacagatttggggtaacccaagatgttggcaattgtagagttgagttgagagagtatggaagatatatctacacc |
21617149 |
T |
|
| Q |
190 |
atcaaagctaacgtttgttgaaagggtgagacaaggcatcttcacttcacttcactctttgcttctttttcatctcactc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21617148 |
atcaaagctaacgtttgttgaaagggtgagacaaggcatcttcacttcacttcactctttgcttcttttttatctcactc |
21617069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 239
Target Start/End: Original strand, 24193711 - 24193780
Alignment:
| Q |
170 |
atggaagatatatctacaccatcaaagctaacgtttgttgaaagggtgagacaaggcatcttcacttcac |
239 |
Q |
| |
|
||||| |||| |||||||| || |||||||||||||||||||||||||||||| ||||| || |||||| |
|
|
| T |
24193711 |
atggatgatacatctacactataaaagctaacgtttgttgaaagggtgagacagagcatcctcccttcac |
24193780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University