View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15546_low_6 (Length: 372)
Name: NF15546_low_6
Description: NF15546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15546_low_6 |
 |  |
|
| [»] scaffold1366 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 13 - 356
Target Start/End: Original strand, 31213474 - 31213816
Alignment:
| Q |
13 |
cagattgcatttagaggtcaaaaattgtggttatcgatggatatttaaggaggatttggagcaattaaacccacaaatgatgtacggtggaaattcctcg |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213474 |
cagattgcatttagaggtcaaaaattgaggttatcgatggatatttaaggaggatttggagcaattaaacccacaaatgatgtacggtggaaattcctcg |
31213573 |
T |
 |
| Q |
113 |
gttcaaaacaagtactccctccatcccttagtataaacatatttcagttatgcctacttctcgctttcagtgctgcatcaacccactaattggaagacaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213574 |
gttcaaaacaagtactccctccgtcc-ttagtataaacatatttcagttatgcctacttctcgctttcagtgctgcatcaacccactaattggaagacaa |
31213672 |
T |
 |
| Q |
213 |
tgccaatcaatagggggatggtaatggatatccaaataagttggtcaagtaaaaggaactcccatagtgtgaatcccattggagtaagggatgagaccgt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213673 |
tgccaatcaatagggggatggtaatggaaatccaaataagttggtcaagtaaaaggaactcccatagtgtgaatcccattggagtaagggatgagaccgt |
31213772 |
T |
 |
| Q |
313 |
gttaatttcacggttctctccctcctcacaattagaatgactct |
356 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31213773 |
gtcaatttcacggttctctccctcctcacaattagaatgactct |
31213816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 17 - 117
Target Start/End: Original strand, 31247902 - 31248002
Alignment:
| Q |
17 |
ttgcatttagaggtcaaaaattgtggttatcgatggatatttaaggaggatttggagcaattaaacccacaaatgatgtacggtggaaattcctcggttc |
116 |
Q |
| |
|
|||||||| ||||| |||||||||||||||| |||||||||||||||||| |||| || ||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
31247902 |
ttgcatttggaggtaaaaaattgtggttatcattggatatttaaggaggatctggaacatttaaacccacaaatgatgtacagtggaaattcctcagttc |
31248001 |
T |
 |
| Q |
117 |
a |
117 |
Q |
| |
|
| |
|
|
| T |
31248002 |
a |
31248002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 31264164 - 31264087
Alignment:
| Q |
17 |
ttgcatttagaggtcaaaaattgtggttatcgatggatatttaaggaggatttggagcaattaaacccacaaatgatg |
94 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||| |||| || |||||| | ||||||||| |
|
|
| T |
31264164 |
ttgcatttggaggtcaaaaattgtggttatcattggatatttaaggaggatctggaacatttaaacgcgcaaatgatg |
31264087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 31304800 - 31304872
Alignment:
| Q |
17 |
ttgcatttagaggtcaaaaattgtggttatcgatggatatttaaggaggatttggagcaattaaacccacaaa |
89 |
Q |
| |
|
|||||||| ||||| || || |||||||| ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
31304800 |
ttgcattttgaggtaaagaactgtggttacagatggatatttgaggaggatctggagcaattaaacccacaaa |
31304872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 37 - 122
Target Start/End: Original strand, 13615656 - 13615741
Alignment:
| Q |
37 |
ttgtggttatcgatggatatttaaggaggatttggagcaattaaacccac--aaatgatgtacggtggaaattcctcggttcaaaaca |
122 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||| | ||||||| || | |||||||||||| |||||||||| |
|
|
| T |
13615656 |
ttgtggttatcgttggatatttgaggaggatttggagcaattaaacccccgcaaatgat-ta-gttggaaattcctcagttcaaaaca |
13615741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1366 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1366
Description:
Target: scaffold1366; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 247 - 309
Target Start/End: Complemental strand, 1711 - 1649
Alignment:
| Q |
247 |
aataagttggtcaagtaaaaggaactcccatagtgtgaatcccattggagtaagggatgagac |
309 |
Q |
| |
|
|||||| |||||||||| |||||||||||| |||||||| ||| |||||||| | |||||||| |
|
|
| T |
1711 |
aataagctggtcaagtagaaggaactcccagagtgtgaagccccttggagtaggagatgagac |
1649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University