View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15547_low_3 (Length: 316)
Name: NF15547_low_3
Description: NF15547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15547_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 3010717 - 3010538
Alignment:
| Q |
18 |
gatatattgtgggtttgagcgacttgaaacttgtccgaactgggtaaattggattgtaacctctgtataacgttggcttgaaattttgtacaagtgctga |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3010717 |
gatatattgtgaatttgagcgacttgaaacttgtccgaactgggtaaattggattgtaacctctgtataacgttggcttgaaattttgtacaagtgcaga |
3010618 |
T |
|
| Q |
118 |
aggaattgttgcagtgtgttgccatgagaggtggtggtaacggtttttcggtggaggacctgatacttgatgggaagaag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3010617 |
aggaattgttgcagtgtgttgccatgagaggtggtggtaacggtttttcggtggaggacctgatacttgatgggaagaag |
3010538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 255 - 316
Target Start/End: Complemental strand, 3010460 - 3010401
Alignment:
| Q |
255 |
ctgaactattgaaaattattttgctacgtgtcgcaaatcgatatgaagcaaacttggaaact |
316 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3010460 |
ctgaaccattgaaaattattttgctacgtgtcgcaaatcg--atgaagtgaacttggaaact |
3010401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University