View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15549_high_12 (Length: 221)
Name: NF15549_high_12
Description: NF15549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15549_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 42741461 - 42741534
Alignment:
| Q |
1 |
agtgtatattagtcaaataaaatgaaatttattaaaataaagttacaatattccctcttgatattgacacagat |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42741461 |
agtgtatattagtcaaataaaatgaaatttattaaaataaagttacaatattccctcttgatattgactcagat |
42741534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 213
Target Start/End: Original strand, 42741644 - 42741674
Alignment:
| Q |
183 |
tatttttgctacaatcttcctttctttaccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42741644 |
tatttttgctacaatcttcctttctttaccc |
42741674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University