View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1554_low_10 (Length: 251)
Name: NF1554_low_10
Description: NF1554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1554_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 15850018 - 15850259
Alignment:
| Q |
1 |
taacatagttatctctgactctgaccccatacctaagaactcagcagagtttgtgtctgctactgagtttcaacattctcagcggatgttagagctgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| ||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15850018 |
taacatagttatctctgactctgacccaagacctcagaactctgctgagtttgtgtctgctactgagtttcaacattcttagcggatgttagagctgaat |
15850117 |
T |
 |
| Q |
101 |
tggcttctcaacatgttgttcaaatttaaatgcagaaccaacttaaagggcaattagagactcaagttgtagtgaagactcaacctatgaagcacggaca |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15850118 |
tggcttctcgacatgttgttcaaatttaaatgcagaaccaacttaaagggcaattagagactcaagttgtagtgaagactcaacctatgaagcacggaca |
15850217 |
T |
 |
| Q |
201 |
cctcttgaaccaaccgtgttacggtgtccgacattcctatga |
242 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
15850218 |
cctcttgaaccagccgtattacggtgtccgacactcctatga |
15850259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 43921666 - 43921714
Alignment:
| Q |
185 |
ctatgaagcacggacacctcttgaaccaaccgtgttacggtgtccgaca |
233 |
Q |
| |
|
||||||||||||||||||||| | || | |||||| ||||||||||||| |
|
|
| T |
43921666 |
ctatgaagcacggacacctctaggactagccgtgtcacggtgtccgaca |
43921714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University