View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1554_low_12 (Length: 234)
Name: NF1554_low_12
Description: NF1554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1554_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 118 - 227
Target Start/End: Complemental strand, 1539363 - 1539254
Alignment:
| Q |
118 |
tgccaccactttcgacacgtattcttgcattgtattgttacttctctggtttagcggaggaggttggattggttgggaaaatttttgcaacaccgcctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
1539363 |
tgccaccactttcgacacgtattcctgcgttgtattgttacttctctggtttggcggaggatgttggattggttgggaaaaaatttgcaacaccgcataa |
1539264 |
T |
|
| Q |
218 |
tttatttgtt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
1539263 |
tttatttgtt |
1539254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 3 - 75
Target Start/End: Complemental strand, 1539480 - 1539408
Alignment:
| Q |
3 |
cacagacagaccgtcaaaccaattacgtggaaaagataatgttagtatattggcctgtcagcacaccaccact |
75 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1539480 |
cacagacggaccgtcaaaccaattacagggaaaagataatgttagtatattggcctgtcagcacaccaccact |
1539408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University