View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1554_low_3_N (Length: 354)
Name: NF1554_low_3_N
Description: NF1554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1554_low_3_N |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 30 - 283
Target Start/End: Original strand, 11897382 - 11897617
Alignment:
| Q |
30 |
aaattcaatggatctttctcaaatccctaaggctcatcatcgtagacgcagtggagcctctggtcttctgccaaattttcactaggctcaatgttattgg |
129 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11897382 |
aaattcaatggatctttcttaaatccctaaggctcatcatcgtagacgcagtggagcctctggtcttctgccaaatt------------------attga |
11897463 |
T |
 |
| Q |
130 |
tttcgacaaccannnnnnngttgcatttcagcctctaaagctgctttccacttttttcggccacataggtcgtaatcttagcccaagcactaggctcgga |
229 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
11897464 |
tttcgacaaccatttttttgttgcatttcaacctctaaagctgctttccacttttttcggccacataggccgtaatcttagcccaagcactaggctcaga |
11897563 |
T |
 |
| Q |
230 |
cattttaattttcatcatttccccaaccagttggtgggattaccccttcctctg |
283 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11897564 |
cattttaattttcatcatttccctaaccagttggtgggattaccccttcctctg |
11897617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University