View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_high_15 (Length: 217)
Name: NF15550_high_15
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_high_15 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 48044606 - 48044390
Alignment:
| Q |
13 |
atatttctgttactcattgatctgtgattgaggtttgcaacgatggtccggcctacgggatatagaatgggatcaataatttatgacacccacaatcagg |
112 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48044606 |
atatttctgttattcattgctctgtgattgaggtttgcaatgatggtccggcctacgggatatagaatgggatcaataatttatgacgcccacaatcagg |
48044507 |
T |
|
| Q |
113 |
tgacaagaatca------------caatagaagatgcaattgaagataggagacgcacagaggagtgaaagcatcttaagcttgggtctcacacatgaca |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48044506 |
tgacaagaatcacaatgattgtcgcaatagaagatgcaatagaagataggagacgcacagaggagtgaaagcatcttaagcttgggtctcacacatgaca |
48044407 |
T |
|
| Q |
201 |
caacctaattgatcaac |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48044406 |
caacctaattgatcaac |
48044390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University