View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_high_16 (Length: 214)
Name: NF15550_high_16
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 21083615 - 21083815
Alignment:
| Q |
1 |
acttgctttggacccattgcatggccatatattgttgagggctaagactaccatatccagatggagagacagatggtgattggcatgaggcaggactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21083615 |
acttgctttggacccattgcatggccatatattgttgagggctaagactaccatatccagatggagagacagatggtgattggcatgaggcaggactttg |
21083714 |
T |
 |
| Q |
101 |
aatggtacaaccttgtaatttgaagtttgtgtaccttccaacaaagggttgatatttataatcagctttgtattttccatcttctgttgcccaagaagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21083715 |
aatggtacaaccttgtaatttgaagttagtgtaccttccaacaaagggttggtatttataatcagctttatattttccatcttctgttgcccaagaagat |
21083814 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
21083815 |
g |
21083815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 120 - 193
Target Start/End: Original strand, 27684117 - 27684190
Alignment:
| Q |
120 |
ttgaagtttgtgtaccttccaacaaagggttgatatttataatcagctttgtattttccatcttctgttgccca |
193 |
Q |
| |
|
||||||||||||||| || ||||||| ||||| || || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27684117 |
ttgaagtttgtgtactttgcaacaaaaggttggtacttgtaatcagctttgtattttccatcttctgttgccca |
27684190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 193
Target Start/End: Complemental strand, 41270376 - 41270322
Alignment:
| Q |
139 |
caacaaagggttgatatttataatcagctttgtattttccatcttctgttgccca |
193 |
Q |
| |
|
||||||| ||||| ||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41270376 |
caacaaatggttggtatctgtaatcagctttgtattttccatcttctgttgccca |
41270322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 103 - 193
Target Start/End: Complemental strand, 40872082 - 40871992
Alignment:
| Q |
103 |
tggtacaaccttgtaatttgaagtttgtgtaccttccaacaaagggttgatatttataatcagctttgtattttccatcttctgttgccca |
193 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||| |||||||| || |||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
40872082 |
tggtacaaccttgtagtttgaagttttggtatcttccaatgaagggttggtaagtataatttgctttgtattttccattctctgtagccca |
40871992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University