View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_high_6 (Length: 314)
Name: NF15550_high_6
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 28 - 305
Target Start/End: Complemental strand, 21083502 - 21083225
Alignment:
| Q |
28 |
tctcttacgcaattttcaacaaactctcgatgattgaaatttatacttgtctcatataaatttcaatatgtagaaagaagtcagttgaaaagtgtgtgtt |
127 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21083502 |
tctcttacgcatttttcatcagactctcgatgattgaaatatatactggtctcatataaatttcaatatgtagaaagaagtcagttgaaaaatgtgtgtt |
21083403 |
T |
 |
| Q |
128 |
aaagagcgatattgttattattgattctctctacacataatattttagttgtgagagtttgttttatttattttaagggtggttttttgtgatggtcccg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21083402 |
aaagagcgatattgttattattgattctctctacacataatattttagttgtgagagtttgttttatttattttaagggtggttttttgtgatggtcccg |
21083303 |
T |
 |
| Q |
228 |
cttgcaagtgtaaaaggaagagcggttgaacgtccaaaccctcctatgattggaatgtttttgttgtatttgtctgtg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21083302 |
cttgcaagtgtaaaaggaagagcggttgaacgtccaaaccctcctatgattggaatgtttttgttgtatttgtgtgtg |
21083225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University