View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_high_9 (Length: 279)
Name: NF15550_high_9
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 5 - 269
Target Start/End: Original strand, 40107404 - 40107665
Alignment:
| Q |
5 |
ctctactaaaatgatatatgcttacattcaaaaatcagttgccatagattagcattgtctgatgaggttccttccttaaaatttcaacagaccatcatag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107404 |
ctctactaaaatgatatatgcttacattcaaaaatcagttgccatagattagcattgtctgatgaggttccttccttaaaatttcaacagaccatcatag |
40107503 |
T |
|
| Q |
105 |
actagttatgtgaaaatgcagccacaagggaagttctgtgatatccagaacttaaccgcactatttttgtctctctccattttaaaaataagaagttttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40107504 |
actagttatgtgaaaatgcagccacaagggaagtactgtgatatccagaacttaaccgcactatttttgtctctctccattttaaaaat---aagttttc |
40107600 |
T |
|
| Q |
205 |
ttgacatctccgtgatgaatttctgcaatgtatctctttctctttgtcaccttttttgttctgtg |
269 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40107601 |
ttgacatttccgtgatgaatttctgcaatgtatctctttctctttgtcatcttttttgttctgtg |
40107665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University