View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_low_14 (Length: 312)
Name: NF15550_low_14
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 67 - 171
Target Start/End: Original strand, 6704996 - 6705100
Alignment:
| Q |
67 |
gtaaattaattataaatgaaaattacctctgattcactctcaagtttgagtttactaaccaaatacttgaatagcaaccgaactgtcatccttccatctc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6704996 |
gtaaattaattataaatgaaaattacctctgattcactctcaagtttgagtttgctaaccaaatacttgaatagcaaccgaactgtcatccttccatctc |
6705095 |
T |
|
| Q |
167 |
tgaat |
171 |
Q |
| |
|
||||| |
|
|
| T |
6705096 |
tgaat |
6705100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 271
Target Start/End: Original strand, 6705161 - 6705200
Alignment:
| Q |
232 |
agtgaacgacattgattacacactgacaagactttaaacc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6705161 |
agtgaacgacattgattacacactgacaagactttaaacc |
6705200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University