View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_low_24 (Length: 240)
Name: NF15550_low_24
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_low_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 18611705 - 18611941
Alignment:
| Q |
1 |
tgtgtgtggaggtgaattgccccttacttctgtgttcaaagatccactctctacagagtctagaatggaaaaggtaagtgaaaagccatgaaagcttttg |
100 |
Q |
| |
|
||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18611705 |
tgtgtgtggaggtgaattgccacctacatctgtgttcaaagatccactctctacagagtctagaatggaaaaggtaagtgaaaagccatgaaagcttttg |
18611804 |
T |
 |
| Q |
101 |
ttttctcatcttattgaaaactccataaaattctttttaacccctctctcacccctttttatcttttatcaaaaaagatggagagaaagaggtttcaaag |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18611805 |
ttttctcatcttattgaatactccataaaattctttttaacccctctctcacccctttttatcttttatcaaaaaagatggagagaaagaggttacaaag |
18611904 |
T |
 |
| Q |
201 |
aaacaacaattgtatataaacccaaaaaattattttgtat |
240 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18611905 |
a---aacaattgtatataaacccaaaaaaatattttgtat |
18611941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University