View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_low_25 (Length: 224)
Name: NF15550_low_25
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 2873951 - 2874138
Alignment:
| Q |
16 |
ataatactattataaagttctcttatactagaaaagttaaattactctcgaaaaattagagaaagatcgaaaaaattagattagtcttcaattttgacgt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2873951 |
ataatactatt-taaagttctcttatactagaaaagttaaattactctcgaaaaattagagaaagatcgaaaaaattagattagtcttcaattttgacgt |
2874049 |
T |
|
| Q |
116 |
ttctaagacttcatttttcacctctaatttttctattgcagatactggggttggatatatgtgctgataccatggtaggagatgaaatg |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2874050 |
ttctaacacttcatttttcacctctaatttttctattgcagatattggggttggatatatgtgctgataccatggtaggagatgaaatg |
2874138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 44213582 - 44213528
Alignment:
| Q |
151 |
ttgcagatactggggttggatatatgtgctgataccatggtaggagatgaaatgt |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
44213582 |
ttgcagattttggggttggatatatgtgcggataccatggtaggggatgaaatgt |
44213528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 44225733 - 44225689
Alignment:
| Q |
161 |
tggggttggatatatgtgctgataccatggtaggagatgaaatgt |
205 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
44225733 |
tggggttggatatatgcgcggataccatggtgggagatgaaatgt |
44225689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Complemental strand, 44236546 - 44236502
Alignment:
| Q |
161 |
tggggttggatatatgtgctgataccatggtaggagatgaaatgt |
205 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
44236546 |
tggggttggatatatgcgcggataccatggtgggagatgaaatgt |
44236502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University