View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15550_low_7 (Length: 432)
Name: NF15550_low_7
Description: NF15550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15550_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 5448443 - 5448227
Alignment:
| Q |
19 |
cattccaagatcaatttatggccaatgtgtgtattgagattttggctcatgtgcttttctttatttctttgtcttgacattacttgtctgatttgtaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
5448443 |
cattccaagatcaatttatggccaatgtgtgtattgagattttggctcatgtgcttttctttatttctttgtcctggcattacttgtctgatttgtaaag |
5448344 |
T |
 |
| Q |
119 |
gtaacaagttttgcttactatagcta-----tacatttctgctaggtgcaggacccagtcatcaaatagattgttacctaaaaatgagtaagttctagtc |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5448343 |
gtaacaagttttgcttactatagctatacagtacatttctgctaggtgcaggacccagtcatcaaacagattgttacctaaaaatgagtaagttctagtc |
5448244 |
T |
 |
| Q |
214 |
ttcaacttccaagtatc |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5448243 |
ttcaacttccaagtatc |
5448227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 271 - 417
Target Start/End: Complemental strand, 5448186 - 5448040
Alignment:
| Q |
271 |
ctatgggtaacaccctaacatgtcgttgtctcagctcacccatcatccataattgcgctctcattctttcaaggactttatattttacagatannnnnnn |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5448186 |
ctatgggtaacaccctaacatgtcgttgtctcagctcacccatcatccataattgctctctcattctttcaaggactttatattttacagatattttttt |
5448087 |
T |
 |
| Q |
371 |
acccatttgcatgggtcattggcatgcaaatacaccactctcctatg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5448086 |
acccatttgcatgggtcattggcatgcaaatacaccactctcctatg |
5448040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University