View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15551_high_25 (Length: 224)

Name: NF15551_high_25
Description: NF15551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15551_high_25
NF15551_high_25
[»] chr3 (1 HSPs)
chr3 (13-205)||(28564166-28564360)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 28564360 - 28564166
Alignment:
13 atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggacctgaagggattgtcga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||    
28564360 atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggagctgaagggattgttga 28564261  T
113 cagccccttattaacagttgggaaaaaccagattgtccaaatttaaat--aatactatagcagctccaatccgacagcatgaacacagcgattac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||| ||||||    
28564260 cagccccttattaacagttgggaaaaaccagattgtccaaatttaaatacaatactatagcagctctaatccgacagcatgaacacagggattac 28564166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University