View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15551_low_21 (Length: 279)
Name: NF15551_low_21
Description: NF15551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15551_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 13 - 260
Target Start/End: Complemental strand, 34012203 - 34011948
Alignment:
| Q |
13 |
catcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcaannnnnn |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012203 |
catcatcagtggtgttgtagtaatagtgttgcatgtttgaattaaaacttgagtgatgttgatcgggggccatggatggaggatatatgatcagagagag |
34012104 |
T |
 |
| Q |
113 |
nnnnnnn--------atgaagaaaaaatgaagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaagagagaa |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012103 |
agagagagagagagaatgaagaaaaaattgagtggttagttagttatattaagggaaatgagatgcatgcaaagggtaagagtgaggtgggaagagagaa |
34012004 |
T |
 |
| Q |
205 |
catgaaaggaaactgatggatggtagctagcttttggagtataatgacgttgccat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34012003 |
catgaaaggaaactgatggatggtagctagcttttggagtataatgacgttgccat |
34011948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University