View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15551_low_28 (Length: 224)
Name: NF15551_low_28
Description: NF15551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15551_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 205
Target Start/End: Complemental strand, 28564360 - 28564166
Alignment:
| Q |
13 |
atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggacctgaagggattgtcga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
28564360 |
atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggagctgaagggattgttga |
28564261 |
T |
 |
| Q |
113 |
cagccccttattaacagttgggaaaaaccagattgtccaaatttaaat--aatactatagcagctccaatccgacagcatgaacacagcgattac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
28564260 |
cagccccttattaacagttgggaaaaaccagattgtccaaatttaaatacaatactatagcagctctaatccgacagcatgaacacagggattac |
28564166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University