View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_high_41 (Length: 250)
Name: NF15554_high_41
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 82 - 240
Target Start/End: Original strand, 24002092 - 24002250
Alignment:
| Q |
82 |
gagttgagttcgcgggttcaaaatatcaaacctgctaaccaagccaaacaccaataaatttgaatgagttggtttgggttggacttgaacttaatcagaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24002092 |
gagttgagttcgcgggttcaaaatatcaaacctgctaaccaagccaaacaccaataaatttgaatgagttggtttgggttggacttgaacttaatcagaa |
24002191 |
T |
 |
| Q |
182 |
tttggataaaatgcaagtcaggttggattacgtggttccccgtttgacctgtacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24002192 |
tttggataaaatgcaagtcaggttggattacgtggttccccgtttgacctgtacctatg |
24002250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University