View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_high_42 (Length: 250)
Name: NF15554_high_42
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_high_42 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 158 - 250
Target Start/End: Original strand, 2243799 - 2243891
Alignment:
| Q |
158 |
ttgattatacgttttcttgtagtatcaaagttatatgtattaggttaacaaattaatctatttactaaatgctgatactgatttttatgtttc |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2243799 |
ttgattatactttttcttgtagtatcaaagttatatgtattaggttaacaaattaatctatttactaaatgccgatactgatttttatgtttc |
2243891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 106 - 165
Target Start/End: Original strand, 2243724 - 2243783
Alignment:
| Q |
106 |
cattcaacatgtaagaatccccaaacttcattctttttgcttttcaatgatcttgattat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2243724 |
cattcaacatgtaagaatccccaaacttcattctttttgcttttcaatgattttgattat |
2243783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 2243682 - 2243731
Alignment:
| Q |
36 |
ctcaaaaaaccgttctcaactttcctctcgttctctcaaactcactcaac |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
2243682 |
ctcaaagaaccgttctcaactttcctctcgttctctcaacctcattcaac |
2243731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University