View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_high_48 (Length: 236)
Name: NF15554_high_48
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_high_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 42150035 - 42149816
Alignment:
| Q |
1 |
tgctgtggttgccttcttaattgttatctatggctaatggctttatcataatttgtatctctgctaataataatcaagcttgcacactggcttctttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150035 |
tgctgtggttgccttcttaattgttatctatggctaatggctttatcataatttgtatctctgctaataataatcaagcttgcacactggcttctttatg |
42149936 |
T |
|
| Q |
101 |
acatattcaattaacatgatacagatatcaagccaagcttcagcataacctgacttttctcgccaaactggctgattttggaccccaggcgaggccacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42149935 |
acatattcaattaacatgatacagatatcaagccaagcttcagcataacctgacttttctcgccaaactggctgattttggaccccaggcgaggccacag |
42149836 |
T |
|
| Q |
201 |
gcacaaacacattctcaggt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42149835 |
gcacaaacacattctcaggt |
42149816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 125 - 159
Target Start/End: Original strand, 30835629 - 30835663
Alignment:
| Q |
125 |
atatcaagccaagcttcagcataacctgacttttc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30835629 |
atatcaagccaagcttcagcataacctgacttttc |
30835663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University