View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_high_52 (Length: 218)
Name: NF15554_high_52
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_high_52 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 44033716 - 44033938
Alignment:
| Q |
1 |
attgtaattgaatgtactaattaatattccaaggtaactaactgcaaatgagggtggctgcaagctgctgcctaacattgccaagaacttgggttggata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44033716 |
attgtaattgaatgtactaattaatattccaaggtaactaactgcaaatgagggtggctgcaagctgctgcctaacattgccaagaacttgggttggata |
44033815 |
T |
 |
| Q |
101 |
catttactcaaacatgagttattggtcattggttctag-aaagacaattttggaatcccttgatatttttagagacgggtcgcttc----atattattat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44033816 |
catttactcaaacatgagttattggtcattggttctagaaaagacaattttggaatccattgatatttttagagacgggtcgcttcatatatattattat |
44033915 |
T |
 |
| Q |
196 |
tctttatatgaattattgataag |
218 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
44033916 |
tatttatatgaattattgataag |
44033938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University