View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_high_55 (Length: 202)
Name: NF15554_high_55
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 25712117 - 25711948
Alignment:
| Q |
19 |
gatcattggtcgtatccttcttggcattggcattggatttggtaacaaggtaacttgaatgcttcaaaatgataaataatgagtttatgtctttgtgaca |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25712117 |
gatcattggtcgtatccttcttggcgttggcattggatttggtaaccaggtaacttgaatgcttcaaaatgataaataatgagtttatgtctttgtgaca |
25712018 |
T |
 |
| Q |
119 |
acgtcgttcttcaaactgcacttttggacatgtatgctaagtgccatctcttatcttatgccagaataatct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
25712017 |
acgtcgttcttcaaactgcacttttggacatgtatgctaagtgcca--tcttatcttatgccagaaaaatct |
25711948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 43379794 - 43379884
Alignment:
| Q |
19 |
gatcattggtcgtatccttcttggcattggcattggatttggtaacaaggtaacttgaatgcttcaaaatgataaataatgagtttatgtc |
109 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43379794 |
gatcattggtcgtatcctccttggtgttggcattggatttggtaaccaggtaacttgaatgcttcaaaatgataaataatgtgtttatgtc |
43379884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 114 - 190
Target Start/End: Original strand, 45554867 - 45554943
Alignment:
| Q |
114 |
tgacaacgtcgttcttcaaactgcacttttggacatgtatgctaagtgccatctcttatcttatgccagaataatct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
45554867 |
tgacaacgtcgttcttcaaactgcacttttggacatgtatgctaagtgccatctcttattttatgccagaaaaatct |
45554943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University