View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15554_low_22 (Length: 425)
Name: NF15554_low_22
Description: NF15554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15554_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 42150669 - 42150267
Alignment:
| Q |
1 |
atgatagattttttctttctttgatgttgaggatgatagattttactacatgattttggctataaatgcatatgtattttatcacattatcacccattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150669 |
atgatagattttttctttctttgatgttgaggatgatagattttactacatgattttggctataaatgcatatgtattttatcacattatcacccattca |
42150570 |
T |
|
| Q |
101 |
atcaacaatttaaattggtaactctatgtcttcaaatgaacttctcactttagaagagttaaatccatagaaaacatgtctggtatttattcttcttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150569 |
atcaacaatttaaattggtaactctatgtcttcaaatgaacttctcactttagaagagttaaatccatagaaaacatgtctggtatttattcttcttatt |
42150470 |
T |
|
| Q |
201 |
ctttttgtgatatgtgcaccatgagctgatatccacttgtttgaaaatgattgcgctgtcaagtatttgggttgcctaagtaagtgctctagattctcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42150469 |
ctttttgtgatatgtgcaccatgagctgatatccacttgtttgaaaatgattgcgctgtcaagtatttgggttgcctaagtaagtgctctagattctcat |
42150370 |
T |
|
| Q |
301 |
atattttattatagcctgttacattaaattgtaattactgacgccatttcacaaaacagaatagtatttatgttgtcccaaattatttgtctttccggtt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42150369 |
atattttattatagcctgttacattaaattgtaattactgacgccatttcacaaaacagaatagtatttatgttgtcccaaattattcgtctttccggtt |
42150270 |
T |
|
| Q |
401 |
gaa |
403 |
Q |
| |
|
||| |
|
|
| T |
42150269 |
gaa |
42150267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University